Introduction
The apple blue mold disease is the most common
postharvest disease of apples, and its pathogenic fungus is Penicillium
expansum (Palou et al. 2016). Collisions between
fruits occur as they are stored or transported and can lead to mechanical damage.
At this time, the P. expansum spores originally lurk on fruit surfaces
and invade the fruits through wounds and produce mycelia. Mycelia cause fruit
decay and produce the secondary metabolite patulin, which endangers human
health and causes serious food safety problems (Al-Rawashdeh et al. 2015).
The use of chemical fungicides, such as grim zine and flusilazole, to prevent
the postharvest apple blue mold disease of apples has quick and good effects,
but their long-term use can easily cause pathogenic fungus to develop drug
resistance and endanger food safety. With the continuous increase in the
people’s awareness of environmental protection, biological fungicides are
increasingly used in the prevention and treatment of plant diseases (Spadoni et
al. 2015; Spadaro and Droby 2016). Among biological fungicides, Bacillus
spp. is known for its high
environmental tolerance and the production of various peptides and lipids. The
characteristics of fungicidal substances such as lipopeptides have become the
current hotspots of research on biological fungicides. Bacillus
amyloliquefaciens can produce dozens of lipopeptide antibiotics. The
lipopeptide antibiotics produced by B. amyloliquefaciens are divided
into three families, namely, suractin, iturin, and fengycin, in accordance with
their amino acid configurations. Iturin has strong antifungal activity.
Fengycin can substantially inhibit the growth of filamentous fungi. Surfactin
has strong surfactant activity, and its strong emulsifying and foaming
capabilities can reduce the surface tension of liquids effectively. In
addition, suractin has hemolytic, antiviral, antibacterial, and other
biological activities (Wu et al. 2005; Walia and Cameotra 2015; Malmsten
2016). Given their important biological activities, many lipopeptides have been
isolated and identified from Bacillus strains, and their biological
functions have been elucidated at the genetic level.
B. amyloliquefaciens
BA-16-8, an antagonistic bacterium (Fu et al. 2020), is effective in
inhibiting Penicillium spp. lipopeptide antibiotics. Testing the capability of
these two substances to inhibit the performance of P. expansum has
revealed that fengycin is the main substance in B. amyloliquefaciens
BA-16-8 that inhibits P. expansum. This study intends to use
molecular genetics technology to construct the fengycin deletion mutant of B.
amyloliquefaciens BA-16-8 to further verify this conclusion. Moreover, this
study aims to combine antigungal experiment and fruit biocontrol experiments to
confirm that the fengycin in B. amyloliquefaciens inhibits P.
expansum. This study could lay a foundation for exploring the antibacterial
mechanism of B. amyloliquefaciens.
Materials and Methods
Materials
The wild-type B.
amyloliquefaciens BA-16-8 strain was collected through laboratory breeding.
The fengycin gene expression deletion mutant B. amyloliquefaciens BA-16-8 (Δfen) was constructed. The
pathogenic fungus P. expansum was
obtained from the Shaanxi Institute of Microbiology. Escherichia coli
DH5α and pMAD were procured from Takara. pMAD-Δfen,
which was B. Amyloliquefaciens with a fenC deletion (its promoter structure) and pMAD, was constructed in this
work. Genome extraction kits, Taq DNA polymerase, Deoxynucleotides (Deoxynucleotide
triphosphates (dNTPs), restriction enzymes,
and DNA markers were purchased from the Neb Company. PCR product purification
and plasmid extraction kits were acquired from Takara. Acetonitrile,
trifluoroacetic acid, and methanol were purchased from Sigma.
The Agilent 1100 series
high-performance liquid chromatography (HPLC) system was bought from Agilent.
The liquid chromatography–electrospray mass spectrometer system comprised the
Waters Alliance 2690 HPLC apparatus (Waters Company, U.S.A.) and the TSQ
Quantum Discovery A three-stage quadrupole mass
spectrometer (Thermo Fisher Scientific, U.S.A.). The primers used to amplify
the upper and the lower arms of the fengycin synthase C gene (7647 bp) of B.
amyloliquefaciens were designed on the basis of the genomic sequence of B.
amyloliquefaciens Q426 strain in NCBI, and the primers for the resistance
gene spc were based on the plasmid. The design of PUS19 was completed
using the Primer Premier 5.0 software. The specific information is shown in
Table 1. Primer synthesis and sequence determination were completed by Shanghai
Shengong.
Beef extract peptone (BEP)
medium was specifically formulated in reference to the literature (Afsharmanesh
et al. 2014). The BEP agar was prepared in plate form, and the BEP broth
was prepared in the form of liquid medium and used for the cultivation of
antagonistic bacteria. Potato dextrose agar and broth were formulated in
reference to the literature (Afsharmanesh et al. 2014) and used for the
cultivation of pathogenic bacteria.
Shuttle plasmid pMAD
constructs for the deletion mutant BA-16-8Δfen
A genomic DNA extraction kit was utilized to extract the
genomic DNA of BA-16-8, which was used as a template, and P1/P2 were used as
primers to amplify the upstream fenC fragment with length of 1844 bp.
The amplified fragment was applied as the upstream homology arm, and P3/P4 were
utilized as primers to amplify the downstream fragment with an amplification
length of 1645 bp for use as downstream homology arm. In reference to the
literature (Avrahami and Shai 2003; Arnaud et al. 2004; Ongena et al.
2007), the plasmid PUS19 sequence was used as a template. The P5/P6 primers of
the mycin resistance gene were designed, and the spectinomycin resistance gene spc
with an amplification length of 1150 kb was amplified. The product obtained
through PCR amplification was digested with restriction enzymes and was recovered via gel
electrophoresis, ligated into the relevant restriction enzyme sites of the pMAD
plasmid, transferred into E. coli DH5α, screened to obtain
pMAD-ΔfenC, and sequenced. The sequence correctness of the constructed
mutant was verified. The homologous recombination process is shown in Fig. 1.
The method of Arnuad (Arnaud et
al. 2004) was used for mutant screening to verify the correctness of the
obtained pMAD-ΔfenC mutant after sequencing, and the electrical conversion
method was performed under the following conditions: voltage, 2 kV;
capacitance, 25 μF; and
resistance, 100 Ω. The mutant was transferred into B. amyloliquefaciens
BA-16-8, and the fengycin synthase gene deletion mutants were screened.
The gene knockout vector
pMAD-Δfen was transferred into competent E. coli DH5α cells,
placed onto a BEP plate containing 100 μg mL-1 X-gal, and cultured at 30°C for 24
h. At this time, the competent cells can express the lacZ gene if
pMAD-Δfen was present or free in the cell or a single exchange had
occurred. Thus, the growth of blue colonies on the plate indicated that both
transformants were successful.
The selected blue colonies
were transferred into BA-16-8 liquid medium, cultured at 42°C and 180 rpm, and
shaken for 24 h. The bacterial cultures were cultured into fresh 50 μg mL-1 spectinomycin
BEP liquid medium at 42°C and shaken at 180 rpm for 12 h. The temperature was
reduced to 30°C, and shaking was continued for 12 h at 180 rpm. The culture
broth was transferred onto a BEP plate containing 100 μg mL-1 X-gal and 50 μg mL-1 spectinomycin
and incubated at 30°C for 24 h. White colonies were selected and transferred
onto a BEP plate containing 3 μg
mL-1 erythromycin. A Mycobacterium-sensitive strain was
defined as the mutant strain BA-16-8Δfen with a deleted fenC gene.
Table 1: Primer information
|
Primer |
Primer
Sequence (5´→3´) |
Target
fragment |
Restriction
site |
Size (bp) |
|
P1 |
CGCGGATC CGCAGATACGCCGAAGCAC |
fenC Upstream arm |
BamHⅠ |
1844 |
|
P2 |
CGCACGCG TCCGCAACGACGCCATTAG |
MluⅠ |
||
|
P3 |
CGC ACGCGTAAAACAGGTCTGCCGCTAT |
fenC Downstream arm |
MluⅠ |
1645 |
|
P4 |
CGCGAATTC GGTGACAAACGCAGTGAAT |
EcoRⅠ |
||
|
P5 |
CGCACGCG TTAGTCACTGTTTGCCACATTCG |
spc gene |
MluⅠ |
1146 |
|
P6 |
CGCGAATTC TGGTTCAGCAGTAAATGGTGG |
EcoRⅠ |
||
|
P7 |
TCTAATACGAATCGATACAC |
fenC gene |
|
7647 |
|
P8 |
AAAGGAGTGATTATGGCTCT |
|
%20655-662_files/image002.jpg)
Fig. 1: Schematic diagram of homologous recombination process
Table 2: HPLC elution conditions
|
Time min |
Surfactin |
Fengycin |
||||
|
|
Acetonitrile
(0.1%TFA) |
Water
(0.1%TFA) |
Flow rate
(mL/min) |
Acetonitrile
(0.1%TFA) |
Water
(0.1%TFA) |
Flow rate
(mL/min) |
|
0 |
20 |
80 |
0.8 |
60 |
40 |
1 |
|
5 |
50 |
50 |
0.8 |
60 |
40 |
1 |
|
15 |
65 |
35 |
0.8 |
90 |
10 |
1 |
|
25 |
65 |
35 |
0.8 |
90 |
10 |
1 |
For the identification of
mutants, BA-16-8Δfen was used as a template, P1/P4 and P7/P8 were
used as primers, and PCR was performed using BA-16-8 as a negative control. The
resulting product was subjected to agarose gel electrophoresis. The size of the
target band was checked for consistency with the predicted size. Bands of the
same size indicated that the spc gene had successfully replaced the fenC
gene, that is, the mutant was successfully constructed. Otherwise, the mutant
was unsuccessfully constructed. Finally, the PCR product was recovered and
sequenced for verification.
HPLC of the wild-type
BA-16-8 and the mutant BA-16-8Δfen strains
For the preparation of the crude extracts of strain
metabolites, the fermentation broths of wild and mutant strains cultured for 24
h were centrifuged at 8000 rpm for 20 min at room temperature. The precipitate
was discarded, and the resulting supernatant was placed in a sterile Erlenmeyer
flask. The pH of the extract was adjusted to 2.0 by using 7 mol L-1 HCl.
Table 3: Components
in each group
|
Group |
Ingredient
A (10 μL) |
Ingredient
B (10 μL) |
|
1 |
B. amyloliquefaciens BA-16-8 bacterial suspension |
P. expansum spore solution |
|
2 |
B. amyloliquefaciens
BA-16-8 lipopeptide Crude extract |
P. expansum
spore solution |
|
3 |
B. amyloliquefaciens BA-16-8Δfen bacteria
suspension |
P. expansum
spore solution |
|
4 |
B. amyloliquefaciens BA -16-8Δfen lipopeptide crude extract |
P. expansum
spore solution |
|
5 |
sterile water |
P. expansum
spore solution |
An aliquot was placed into 10 mL sterile centrifuge
tubes (10 mL each) under aseptic conditions, incubated at 4°C overnight, and
centrifuged at 10 000 rpm for 20 min. The precipitate was collected and mixed
with 0.5 mL neutral methanol solution. This step was performed twice. The
resulting extracts were combined, concentrated five times, and filtered through
a 0.2 μm filter membrane to
obtain the crude extract.
For the separation and
purification of lipopeptide antibiotics by HPLC, the detection wavelength,
column temperature, and injection volume were set to 280 nm, 30°C, and 10 μL, respectively, and the samples
were analyzed through gradient elution. The elution conditions are shown in
Table 2. The components were collected and concentrated using a rotary
evaporator until use.
For the detection of the
antibacterial activity of the wild-type BA-16-8 and the mutant BA-16-8Δfen
strains against P. expansum, each concentrated solution (200 μL) of the wild and the mutant
strains was purified using HPLC and detected using the Oxford cup method. The
lipopeptide of the wild-type BA-16-8 and the mutant BA-16-8Δfen
strains antagonized the ability of P. expansum. The culture temperature
and time were 28°C and 5 days, respectively. The diameter of the zone of
inhibition around the Oxford cup was measured and recorded. The experiment was
performed using sterile water as the control, and the experiments were repeated
thrice.
Control of apple
blue mold disease by the wild-type
BA-16-8 and the mutant BA-16-8Δfen strains
A P.
expansum spore suspension was prepared in reference to the
literature (Shi et al. 2015). The fruit biocontrol test (Fu et al.
2015; Zhang et al. 2015) was used to determine the effect of the
wild-type BA-16-8 and the mutant BA-16-8Δfen strains on the control
of apple blue mold disease. A total of 100 red Fuji apples were used as
samples. The selected apples had the same size and maturity stage. The apples
were sterilized with 75% ethanol and washed with water, and the surface of each
apple was punched with a hole with a diameter of 6 mm and a certain depth by
using a sterile punch. The apples were divided into five groups. The components
in each group are shown in Table 3. The components in each group were treated
into the apples. Each treatment group included 20 apples. The treated apples
were placed in an incubator controlled at 28°C and 95% humidity. After 96 h,
apple infection was observed, and mycelial growth was
quantified.
%20655-662_files/image004.jpg)
Fig. 2: PCR detection of mutant B.
amyloliquefaciensBA-16-8Δfen
Note: M represent DNA marker (15000); Lane 1 represent
the fragment amplified by PCR with P1/P4, taking BA-16-8 genome as template;
Lane 2 represent the fragment amplified by PCR with P7/P8, taking BA-16-8
genome as template; Lane 3 represent the fragment amplified by PCR with P1/P4,
taking B. amyloliquefaciensBA-16-8Δfen
genome as template; Lane 4 represent the fragment amplified by PCR with
P7/P8, taking B. amyloliquefaciensBA-16-8Δfen
genome as template
Results
Construction and
screening of B. amyloliquefaciens BA-16-8fenC gene deletion mutants
Four primers were designed on the basis of the upstream
and downstream sequences of the fenC gene of the first fengycin
synthetase operon of the known strain B. amyloliquefaciens Q426 on NCBI,
and the B. amyloliquefaciens BA-16-8 genome was used as template to
amplify the upstream (upstream arm) and the downstream (downstream arm)
sequences of fenC. The sequencing results showed that PCR amplification
yielded an upstream sequence with a length of 1844 bp and a downstream sequence
with a length of 1645 bp.
Table 4: Antagonistic effect of fractions from wild type and
mutant of BA-16-8 against P. expansum
|
Strain |
Diameter of inhibition zone（mm） |
|
|
a |
b |
|
|
B. amyloliquefaciensBA-16-8 |
0.1± 0.25 |
6.68 ±
0.12 |
|
B. amyloliquefaciensBA-16-8Δfen |
0.1± 0.17 |
— |
The spectinomycin resistance
gene spc was selected to replace the fengycin synthase C gene to
construct a deletion mutation vector. A 1146 bp band
was obtained with the designed spc gene primers and PCR amplification. Each
band was cut with restriction enzymes, and ligases were used for connection to
the pMAD vector in the order of “upstream arm, spc, downstream arm”
individually to construct the fengycin C synthase gene deletion mutation vector
pMAD-Δfen. Δfen and pMAD were used as templates, and the vectors were
identified through PCR using primers P1/P2, P3/P4, and P5/P6. Results showed
that the PCR products with pMAD-Δfen as the template contained the
upstream and the downstream sequences and the spc resistance gene. The
absence of pMAD as a template indicated that the vector was successfully
constructed.
The fengycin C synthase gene deletion mutant BA-16-8-Δfen
was constructed in reference to the method of Arnuad and transferred into B.
amyloliquefaciens BA-16-8 via electro transformation. Blue and white spots
were screened. Positive strains were selected and subjected to plasmid
extraction and enzyme digestion. After double exchange at 30°C and
high-temperature plasmid loss, the fengycin synthase C gene deletion mutants
were finally selected.
PCR was performed using the
BA-16-8ΔfenC as the template, P1/P4 and P7/P8 as primers, and BA-16-8 as
the negative control to identify whether the mutant was constructed
successfully. The resulting product was subjected to agarose coagulation. The
resulting gel electrophoresis bands are shown in Fig. 2. By using primers
P1/P4, up–fenC–down fragments with sizes of 11 kb were obtained from BA-16-8,
and up–spc–down fragments with sizes of 4.6 kb were obtained from
BA-16-8ΔfenC. Using primers P7/P8, a fragment with a size of 7.6kb (fenC)
was obtained from BA-16-8, and no amplified fragment
was obtained from BA-16-8ΔfenC. The above results indicated that the fenC
gene of BA-16-8ΔfenC in the mutant strain BA had been knocked out. The PCR
product was purified and submitted to a company for sequencing. Results further
confirmed that the fenC gene in BA-16-8 had been replaced by the spc
gene.
HPLC of the wild-type
BA-16-8 and the mutant BA-16-8Δfen strains
The crude extracts of the wild-type BA-16-8 and the
mutant BA-16-8Δfen strains were separated and purified using HPLC,
and the resulting fragments are shown in Fig. 3. Two groups of substances (a,
b) were isolated from the wild-type BA-16-8 strain. The retention times of
substances a and b were 21.360 and 41.260 min,
respectively. Substance b was isolated from the mutant strain, and its
retention time was 21.370 min. The surfactin control and fengycin were isolated
under the same elution conditions used to isolate standard samples. The
substances isolated from the wild-type BA-16-8 strain were speculated to be
surfactin and fengycin, and the substances isolated from the mutant BA-16-8Δfen
strain were fengycin.
The materials for HPLC separation and purification were
collected, concentrated, and made up to a volume of 1 mL, and the antibacterial
activity of each fragment was measured through the Oxford cup method. Results
are shown in Table 4. Only component b had significant antagonistic activity.
The mutant strain that had lost the capability to synthesize fengycin showed a
significantly decreased capability to inhibit P. expansum, and its
cell-free fermentation broth almost lost its antibacterial performance. The
comprehensive HPLC, mass spectrometry (MS), and antibacterial performance
analysis results demonstrated that the fengycin from the 16-8 strain inhibited P.
expansum.
Mass spectrometry
BA-16-8 was detected and analyzed through time-of-flight
MS, and the relative molecular mass of each lipopeptide in the crude extract
was obtained. The resulting mass spectrum is shown in Fig. 4, and results are
shown in Table 5. The mass spectrum in Fig. 4A had two series of ion peaks.
Combining the mass spectrum data with the [M + H] +, [M + Na] +, and [M + K] +
ion analysis results in Table 5, the substances were identified as members of
the suractin and fengycin homolog families. The series of ion peaks in Fig. 4B
in combination with the [M + H] +, [M + Na] +, and [M + K] + ion analysis
results in Table 5 indicated that the substances were homologs of the suractin
family. Combining the PCR results with the HPLC results revealed that the
antibacterial lipopeptides extracted from the fermentation broth of the
wild-type BA-16-8 strain were fengycin and suractin, and the antibacterial
lipids were extracted from the fermentation broth of the mutant BA-16-8Δfen
strain. The peptide was surfactin, indicating that the mutant did not produce
fengycin and that the fenC gene deletion mutant was successfully
constructed.
P. expansum controls by the wild-type BA-16-8 and the mutant BA-16-8Δfen strains
Table 5: Mass spectrometric analysis of antifungal compounds from
the cell-free supernatants of BA-16-8 and BA-16-8Δfen
|
Strain |
Fraction |
Experimental charge-mass
ratio (m/z) |
Theoretical charge-mass
ratio (m/z) |
Intensity (%) |
Structure
assignment |
|
BA-16-8 |
Surfactin |
1030.54 |
1030.4 |
47 |
C13-Surfactin, [M+Na]+ |
|
1044.67 |
1044.56 |
24 |
C14-Surfactin, [M+Na]+ |
||
|
1058.78 |
1058.88 |
49 |
C15-Surfactin, [M+Na]+ |
||
|
Fengycin |
1435.61 |
1435.58 |
36 |
C14-FengycinA,[M+Na]+ |
|
|
1449.74 |
144974 |
74 |
C15-FengycinA [M+Na]+ |
||
|
1463.75 |
1463.78 |
56 |
C16-FengycinA, [M+H]+ |
||
|
1477.78 |
1477.82 |
58 |
C17-FengycinA, [M+H]+ |
||
|
1491.82 |
1491.83 |
66 |
C16-FengycinB [M+H]+ |
||
|
1505.64 |
1505.65 |
40 |
C17-FengycinB, [M+H]+ |
||
|
1519.91 |
1519.90 |
16 |
C18-FengycinB, [M+H]+ |
||
|
BA-16-8Δfen |
Surfactin |
1030.54 |
1030.4 |
55 |
C13-Surfactin, [M+Na]+ |
|
1044.67 |
1044.56 |
45 |
C14-Surfactin, [M+Na]+ |
||
|
1058.78 |
1058.88 |
58 |
C15-Surfactin, [M+Na]+ |
%20655-662_files/image006.png)
Fig. 3: HPLC spectra of wildtype strain
B. amyloliquefaciensBA-16-8
(A) and mutant B. amyloliquefaciens BA-16-8Δfen (B)
%20655-662_files/image008.png)
Fig. 4: Mass spectrometric result of antifungal compounds from B. amyloliquefaciens BA-16-8
(A) and B. amyloliquefaciens BA-16-8Δfen
(B)
Table
6: The
effect of different treatments on controlling apple blue mold rot decay
|
Treatment |
Diameter of disease decay（cm） |
Growth of pathogenic fungi |
|
Processing group 1 |
0.01 ±
0.002 |
Sterile
silk |
|
Processing group 2 |
0.02 ±
0.006 |
Sterile
silk |
|
Processing Group 3 |
1.36 ±
0.011 |
Obvious
hyphae |
|
Processing Group 4 |
1.48 ±
0.024 |
Obvious
hyphae |
|
Control group |
1.50 ±
0.036 |
Obvious
hyphae |
The results of the control effects are shown in Table 6.
After 96 h, the bacterial suspension of the wild-type BA-16-8 strain and the
cell-free fermentation broth can strongly inhibit the growth of P. expansum
on the surfaces of apples. The mutant BA-16-8Δfen strain with fenC
gene knockout had a significantly lower control effect than the wild-type
strain. In particular, the lesion diameter under treatment with the cell-free
fermentation broth (group 4) of BA-16-8Δfen was almost the same as
that under treatment with the control. This result indicated that the cells and
lipopeptide extracts of the wild-type BA-16-8 strain can effectively prevent
postharvest apple blue mold disease, and the mutant BA-16-8Δfen
strain can neither synthesize fengycin nor inhibit P. expansum after
losing the capability to synthesize fengycin. The disease prevention capability
was also significantly reduced, providing evidence that B. amyloliquefaciens
BA-16-8 antagonized pathogenic P. expansum and that the main substance
for the prevention and treatment of apple blue mold disease was fengycin.
Discussion
Aiming the biological control of apple blue mold disease,
a strain of amyloid Bacillus BA-16-8, which can effectively inhibit the
pathogen P. expansum, was bred in the laboratory, and the component
conferring an effect of this strain was isolated and purified. The antifungal
activities of the active substances were compared, and the inhibitory effect of
fengycin on P. expansum was significantly higher than that of suractin.
Therefore, fengycin may be the main component
produced by B. amyloliquefaciens to inhibit P. expansum.
In this study, B.
amyloliquefaciensBA-16-8 was used as the experimental object to confirm
this speculation which fengycin is the main substance to inhibit P. expansum.
On the basis of the principle of homologous recombination, the mutant strain
BA-16-8Δfen with a functional fengycin synthase gene defect was
constructed with the help of a temperature-sensitive plasmid pMAD. After PCR,
electrophoresis analysis, and sequence determination, the fengycin synthase C
gene was finally determined to be knocked out successfully. Detecting the
antibacterial activity of lipopeptide proteins produced by mutant and wild
strains in vitro and in vivo revealed the mutation of B.
amyloliquefaciens. The daughter BA-16-8Δfen lost its capability
to synthesize fengycin, inhibit P. expansum, and control apple blue mold
disease. Thus, we determined that fengycin was the main substance that
inhibited P. expansum.
Reports have shown that
fengycin can inhibit a variety of plant pathogens especially filamentous fungi.
However, its specific mechanism of action remains divergent. Some reports have
shown that fengycin can destroy the structure and permeability of bacterial
cell membranes and the cell walls of pathogenic fungi. The lipid layer of the
cell is disrupted, causing the cell structure to be destroyed (Tanaka et al.
2014). Fengycin also contains intracellular substances, such as nucleic acids
(Tao et al. 2011), that can act on pathogenic fungi. However, these
claims have yet to be investigated and confirmed.
Reports have shown the
presence of many clustered genes in the genome of B. amyloliquefaciens
that are used to encode antibacterial peptides and other antifungal substances,
including bacteriocins and lipopeptide antibiotics. However, this finding does
not mean that the same bacterium is in the process of growth and metabolism.
The bacterium can produce all antifungal substances at the same time, and
certain genes used to encode or start antibiotic synthesis must be expressed
normally under certain specific conditions or stages (Ji et al. 2013).
The gene clusters in the genome of B. amyloliquefaciens contain multiple
types of lipopeptide antibiotics. These clusters include sfp, which
encodes suractin; itu, which encodes iturin; and fen, which encodes fengycin.
Testing the antibacterial properties of the lipopeptide of BA-16-8 and BA-16-8 Δfen
revealed that fengycin had a considerable inhibitory effect on P.
expansum.
Conclusion
B.
amyloliquefaciens BA-16-8 could inhibit the growth of P. expansum
and could be the biocide to control apple blue mold disease. The
substance that plays a key role in the process of P. expansum inhibition
is fengycin. However, the exact mechanism of fengycin about its
inhibit effect on the plant disease remain unknown. After determining the key
role of fengycin in the prevention of blue mold disease caused by P.
expansum, we will carry out research on the antagonistic mechanism of
fengycin on P. expansum to provide a theoretical basis for the development
and utilization of antibiotic lipopeptides.
Acknowledgement
This work was financially
supported by the state scholarship fund (China Scholarship Council Program
No.10006) and the Henan Provincial Science and Technology Project
(182102310995, and 182102110002).
Author Contributions
Ruimin Fu planned the experiments and interpreted the
results, Wei Tang made the write up and Yulian Zhang analyzed the data, Wuling Chen
made the illustrations.
References
Afsharmanesh
H, M Ahmadzadeh, M Javan-Nikkhah, K Behboudi (2014). Improvement
in biocontrol activity of Bacillus subtilis utb1 against Aspergillus
flavus using gamma-irradiation. Crop Prot
60:83–92
Al-Rawashdeh ZB, EADM Al-Ramamneh, MR
Karajeh (2015). Efficacy of non-chemical alternatives on blue mold of
apple under controlled cold storage conditions. J Agric Sci 7:112–113
Arnaud M, A Chastanet, M Debarbouille (2004). New vector for efficient allelic replacement in naturally
nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70:6887–6891
Avrahami D, Y Shai (2003). Bestowing
antifungal and antibacterial activities by lipophilic acid conjugation to d,
l-amino acid-containing antimicrobial peptides: A plausible mode of action.
Biochemistry 42:14946–14956
Fu RM, WH Xing, YN Gu, HP Chang, FM Zhang, WL Chen
(2020). Evaluation of antifungal mechanism of Bacillus
amyloliquefaciens BA-16-8. Intl J Agric Biol 23:405–408
Fu RM, F Yu, YN Gu, TT Xue, YZ Guo, YY Wang, XW Wu, ML
Du, WL Chen (2015). Improvement of antagonistic activity of Bacillus
megaterium MHT6 against Fusarium moniliforme using he-ne laser
irradiation. Intl J Agric Biol 17:1141–1148
Ji SH, NC Paul, JX Deng, YS Kim, BS Yun,
SH Yu (2013). Biocontrol activity of Bacillus
amyloliquefaciens CNU114001 against fungal plant diseases. Mycobiology
41:234–242
Malmsten M (2016). Interactions of
antimicrobial peptides with bacterial membranes and membrane components.
Curr Topics Med Chem 16:16–24
Ongena M, E Jourdan, A Adam, M Paquot, A
Brans, B Joris, JL Arpigny, P Thonart (2007). Surfactin and fengycin
lipopeptides of Bacillus subtilis as elicitors of induced systemic
resistance in plants. Environ Microb 9:1084–1090
Palou L, C Montesinos-Herrero,
V Taberner, J Vilella-Esplá (2016). First report of Penicillium
expansum causing postharvest blue mold of fresh date palm fruit (Phoenix
dactylifera) in Spain. Food Contr 60:95–102
Shi JL, YQ Li, KM Hu, JG Ren, HM Liu
(2015). Isolation and identification of pathogens from rotted
root of Pinellia ternata in Guizhou province. Microbiology 42:289–299
Spadaro
D, S Droby (2016). Development of biocontrol products for postharvest diseases
of fruit: The importance of elucidating the mechanisms of action of yeast
antagonists. Trends Food Sci Technol 47:39–49
Spadoni A, F Neri, M Mari (2015). Physical and
chemical control of postharvest diseases. Adv Postharv
Fruit Veg Technol 1:89–90
Tanaka K, A
Ishihara, H Nakajima (2014). Isolation of anteiso-C17,
iso-C17, iso-C16, and iso-C15 bacillomycin D from B. amyloliquefaciens
SD-32 and their antifungal activities against plant pathogens. J
Agric Food Chem 62:1469–1476
Tao Y, XM Bie, FX Lv, HZ Zhao, ZX Lu (2011). Antifungal activity and mechanism of fengycin in the presence and
absence of commercial surfactin against Rhizopus stolonifer. J
Microbiol 49:146–150
Walia NK, SS Cameotra
(2015). Lipopeptides: Biosynthesis and applications. J Microbiol Biochem
Technol 7:103–107
Wu S, SF Jia, DD Sun, ML Chen, XZ Chen, J Zhong, LD Huan
(2005). Purification and characterization of two novel antimicrobial peptides
subpeptin JM4-A and subpeptin JM4-B produced by Bacillus subtilis JM4. Curr
Microbiol 51:292–296
Zhang N, DQ Yang, DD Wang, YZ Miao, JH Shao, X Zhou, ZH
Xu, Q Li, HC Feng, SQ Li, QR Shen, RF Zhang (2015). Whole
transcriptomic analysis of the plant-beneficial rhizobacterium Bacillus
amyloliquefaciens SQR9 during enhanced biofilm formation regulated by maize
root exudates. Biol Med Cent Genomics
16:1–2